haplogroup g origin

Although no basal G-M201* chromosomes were detected in our data set, the homeland of this haplogroup has been estimated to be somewhere nearby eastern Anatolia, Armenia or western Iran, the only areas characterized by the co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. PLoS One 2011; 6: e17548. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. ISSN 1476-5438 (online) Eur J Hum Genet 2007; 15: 485493. Am J Hum Genet 2007; 80: 759768. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. L2b1a. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Distribution. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. In addition, there are multiple other SNPs thought to have the same coverage as M201. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. Google Scholar. Haplogroup G1 is a primary subclade of haplogroup G . [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. CAS [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. The Turkish G-M377 is somewhat closer, but not identical. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. However, interpretations based on coarse haplogroup resolution frequency clines are unsophisticated and do not recognize underlying patterns of genetic diversification. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. Haplogroup G represents one of the first peoples in Europe. The SNP L177 (a.k.a. It is provided at the request of readers. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. Whatever the date or specific place of origin, part of the G family put down roots predominantly in the area south and east of the Caucasus mountains. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This is likely due to a local founder effect.[40]. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. ISSN 1018-4813 (print), Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus, Subdividing Y-chromosome haplogroup R1a1 reveals Norse Viking dispersal lineages in Britain, Phylogenetic analysis of the Y-chromosome haplogroup C2b-F1067, a dominant paternal lineage in Eastern Eurasia, Y-chromosomal connection between Hungarians and geographically distant populations of the Ural Mountain region and West Siberia, Origin and diffusion of human Y chromosome haplogroup J1-M267, Bidirectional dispersals during the peopling of the North American Arctic, The role of matrilineality in shaping patterns of Y chromosome and mtDNA sequence variation in southwestern Angola, Ancient human mitochondrial genomes from Bronze Age Bulgaria: new insights into the genetic history of Thracians, Medieval Super-Grandfather founder of Western Kazakh Clans from Haplogroup C2a1a2-M48, Early medieval genetic data from Ural region evaluated in the light of archaeological evidence of ancient Hungarians, http://harpending.humanevo.utah.edu/popstr/, Population genetic study of 17 Y-STR Loci of the Sorani Kurds in the Province of Sulaymaniyah, Iraq, Phylogenetic history of patrilineages rare in northern and eastern Europe from large-scale re-sequencing of human Y-chromosomes, Sex-biased patterns shaped the genetic history of Roma, Middle eastern genetic legacy in the paternal and maternal gene pools of Chuetas, Cancel See: Poznik. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. The phylogenetic relationships of the various sub-haplogroups investigated are shown in Figure 1. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. (2004) suggested the mutation took place only 9,500 years ago. Origin. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. The complexity is apparent in both the phylogenetic resolution and geographic patterning within hgs G and J2a. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Nei M : Molecular Evolutionary Genetics. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. They are found only in tiny numbers elsewhere. Haplogroup G is a branch on the maternal tree of human kind. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. Genomics 1999; 57: 433437. Ann Hum Genet 2008; 72: 205214. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. For the human mtDNA haplogroup, see. Am J Hum Genet 2004; 74: 788788. Cinnioglu C, King R, Kivisild T et al. This value of 12 is uncommon in other G categories other than G1. Hg G is most common in the Caucasus with a maximum frequency exceeding 70% in North Ossetians,2, 3 decreasing to 13% in Iran4 and then rapidly dissipating further eastward. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. The identification of a new SNP can necessitate renaming of one or more categories. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess the highest levels of G-M201 among any modern ethnic group. Haplogroup G first locations (T. Kandell). K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. Balanovsky O, Dibirova K, Dybo A et al. Am J Hum Genet 2006; 78: 202221. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. Haplogroup G ( M201) is a human Y-chromosome haplogroup. and JavaScript. AAL thanks the Sorenson Molecular Genealogy Foundation. Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. The first principal component separates the populations of the Caucasus from those of Europe, with the Near/Middle Eastern populations being intermediate (Figure 3a). The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. Balanovsky O, Rootsi S, Pshenichnov A et al. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. Almost all L141 men belong to L141 subclades. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective.

City Of Fort Pierce Building Department, Tesla Stem High School Admission Rate, 132 Lily Pond Lane East Hampton, Articles H